Copyright©2018 CSIR-Institute of Genomics and Integrative Biology | VS Lab |
circRNA_555 | |||
Gene | n/a | Organism | Human |
Genome Locus | n/a | Build | hg19 |
Disease | Breast Cancer | ICD-10 | Malignant neoplasm of breast (C50) |
DBLink | Link to database | PMID | 26472973 |
Experimental Method | |||
Sample Type | Mammary gland Tissues | Comparison | Liquid Nitrogen frozen mammary glands harvested from five rats on day 1 and 7 postpartum |
Method for Estimation | Quantitative PCR | PCR Details | |
Primers (Experimented) | Forward GGCACAATACCTTCCAAGTTCA ReverseCCTTCAGTAAGCGTGTCTTCTT | Statistics | Fold Change : Upregulated pvalue : p<0.05 |
Citation | |||
Zhang, C, Wu, H, Wang, Y, Zhao, Y, Fang, X, Chen, C, Chen, H (2015). Expression Patterns of Circular RNAs from Primary Kinase Transcripts in the Mammary Glands of Lactating Rats. J Breast Cancer, 18, 3:235-41. |